ID: 927698617_927698626

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 927698617 927698626
Species Human (GRCh38) Human (GRCh38)
Location 2:25253282-25253304 2:25253320-25253342
Sequence CCCTGTTGGCTCTGCCCTCGAGG TAGACTTGGAGAAATATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191} {0: 1, 1: 0, 2: 5, 3: 29, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!