ID: 927704916_927704927

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 927704916 927704927
Species Human (GRCh38) Human (GRCh38)
Location 2:25291021-25291043 2:25291072-25291094
Sequence CCGTCACGTGCACAGACTTGAGA CACTGCCAGCCACAGGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104} {0: 1, 1: 0, 2: 3, 3: 48, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!