ID: 927742250_927742254

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927742250 927742254
Species Human (GRCh38) Human (GRCh38)
Location 2:25582016-25582038 2:25582038-25582060
Sequence CCCACCACTTTCTTAATGTGAAG GAACAGGATATAAAAAATATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 185} {0: 1, 1: 0, 2: 1, 3: 46, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!