ID: 927812226_927812236

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 927812226 927812236
Species Human (GRCh38) Human (GRCh38)
Location 2:26186472-26186494 2:26186511-26186533
Sequence CCGAGGGTGCAGCTCCCTGTGCA CACTGCTGTCTGGGTGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 243} {0: 1, 1: 0, 2: 3, 3: 19, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!