ID: 927868125_927868132

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 927868125 927868132
Species Human (GRCh38) Human (GRCh38)
Location 2:26606027-26606049 2:26606046-26606068
Sequence CCAAGGGCAGGGGGGAGGCGCGG GCGGGGGAGGGCGAATGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 568} {0: 1, 1: 0, 2: 0, 3: 35, 4: 760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!