ID: 927892383_927892386

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927892383 927892386
Species Human (GRCh38) Human (GRCh38)
Location 2:26759859-26759881 2:26759875-26759897
Sequence CCTTTTTCACAAGTTCGAGGCTG GAGGCTGTCTTAGGGCAAGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!