ID: 927893526_927893534

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927893526 927893534
Species Human (GRCh38) Human (GRCh38)
Location 2:26767133-26767155 2:26767161-26767183
Sequence CCCAGAGTCCCTCCTTCCTGGGA CTCTCACAGCTCCCCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 847} {0: 1, 1: 0, 2: 3, 3: 64, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!