ID: 927893530_927893534

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927893530 927893534
Species Human (GRCh38) Human (GRCh38)
Location 2:26767145-26767167 2:26767161-26767183
Sequence CCTTCCTGGGAGTTTCCTCTCAC CTCTCACAGCTCCCCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 306} {0: 1, 1: 0, 2: 3, 3: 64, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!