ID: 927931733_927931743

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 927931733 927931743
Species Human (GRCh38) Human (GRCh38)
Location 2:27049983-27050005 2:27050008-27050030
Sequence CCGACCCCGACCTCACGTGGGCC GGAGGCTGCAGGGACCTACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 259} {0: 1, 1: 0, 2: 3, 3: 32, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!