ID: 927945646_927945650

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 927945646 927945650
Species Human (GRCh38) Human (GRCh38)
Location 2:27133693-27133715 2:27133710-27133732
Sequence CCATTAATCAGCTCTAGCTGCAG CTGCAGAAAGTGCTGTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124} {0: 1, 1: 0, 2: 6, 3: 47, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!