ID: 927945840_927945843

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 927945840 927945843
Species Human (GRCh38) Human (GRCh38)
Location 2:27134663-27134685 2:27134686-27134708
Sequence CCTCCGCGCAGGCGCAGGAGCGC CGACACGCGTCAGCACTAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!