ID: 927956274_927956283

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 927956274 927956283
Species Human (GRCh38) Human (GRCh38)
Location 2:27209706-27209728 2:27209755-27209777
Sequence CCACTAGGAGAAAGATTAGGCTG TTGGGCAGACACTGGCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 129} {0: 1, 1: 0, 2: 2, 3: 14, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!