ID: 927971369_927971373

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 927971369 927971373
Species Human (GRCh38) Human (GRCh38)
Location 2:27307818-27307840 2:27307842-27307864
Sequence CCTCTGGCTGCTCCCAGGGCACA CTGTACCAGGAGCAGCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 446} {0: 1, 1: 0, 2: 5, 3: 17, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!