ID: 927991428_927991435

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927991428 927991435
Species Human (GRCh38) Human (GRCh38)
Location 2:27450192-27450214 2:27450225-27450247
Sequence CCAACTTTTTCTCTTACTCTCCC GCACCCTCCTGGGCAAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 1139} {0: 1, 1: 0, 2: 4, 3: 11, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!