ID: 928040358_928040359

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 928040358 928040359
Species Human (GRCh38) Human (GRCh38)
Location 2:27869802-27869824 2:27869835-27869857
Sequence CCATAATCTCGTTTTGGTTGCTG AAACTCTGCTTCACAAAGATAGG
Strand - +
Off-target summary {0: 5, 1: 22, 2: 10, 3: 16, 4: 100} {0: 2, 1: 26, 2: 40, 3: 50, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!