ID: 928070669_928070670

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 928070669 928070670
Species Human (GRCh38) Human (GRCh38)
Location 2:28212155-28212177 2:28212175-28212197
Sequence CCTGTTAGTTGGAATAGCTTGAG GAGATATTTGCAAATTATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140} {0: 1, 1: 0, 2: 4, 3: 51, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!