ID: 928097294_928097305

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 928097294 928097305
Species Human (GRCh38) Human (GRCh38)
Location 2:28412487-28412509 2:28412526-28412548
Sequence CCTCGCTCCTCCTTCCCAGGGAC TCCAGGGCCGTGAGGGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 490} {0: 1, 1: 0, 2: 0, 3: 21, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!