ID: 928107147_928107150

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 928107147 928107150
Species Human (GRCh38) Human (GRCh38)
Location 2:28477915-28477937 2:28477928-28477950
Sequence CCCTTCTGAGTCTGCTTCTGCAG GCTTCTGCAGGTTCTGTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 366} {0: 1, 1: 0, 2: 0, 3: 10, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!