ID: 928109838_928109841

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 928109838 928109841
Species Human (GRCh38) Human (GRCh38)
Location 2:28497698-28497720 2:28497742-28497764
Sequence CCGTTGTCCATTTGTATATTCTC AGAGTCTGGCTGTGTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 109, 4: 590} {0: 27, 1: 1437, 2: 23020, 3: 85918, 4: 159719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!