ID: 928127828_928127842

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 928127828 928127842
Species Human (GRCh38) Human (GRCh38)
Location 2:28628461-28628483 2:28628511-28628533
Sequence CCACTCAGTCATTTAGCCCAGGC TCTCTCAGAGCGGGCACCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108} {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!