ID: 928175805_928175812

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 928175805 928175812
Species Human (GRCh38) Human (GRCh38)
Location 2:29033634-29033656 2:29033670-29033692
Sequence CCAGGGGTGGCTCTGGGGTGGAC GTATCGCTGAGACCTAGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 284} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!