ID: 928200391_928200397

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 928200391 928200397
Species Human (GRCh38) Human (GRCh38)
Location 2:29244235-29244257 2:29244275-29244297
Sequence CCGTGGGATCCTGGGCAAGGCCC GTTTCCTCATTTGTGAAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 378} {0: 1, 1: 18, 2: 393, 3: 2019, 4: 6457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!