ID: 928200854_928200866

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 928200854 928200866
Species Human (GRCh38) Human (GRCh38)
Location 2:29246814-29246836 2:29246855-29246877
Sequence CCAACTGCTCTCCCCACCTCCAG ACCCTCATGCTTTCACCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 114, 4: 955} {0: 1, 1: 0, 2: 4, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!