ID: 928208543_928208550

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 928208543 928208550
Species Human (GRCh38) Human (GRCh38)
Location 2:29305602-29305624 2:29305625-29305647
Sequence CCCATGCCAAGTATACCCAGCTT GATCTTGGCAGTCAAGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80} {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!