ID: 928214989_928214994

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 928214989 928214994
Species Human (GRCh38) Human (GRCh38)
Location 2:29353974-29353996 2:29353989-29354011
Sequence CCTTTGGTCCTTAAGCACAAGAG CACAAGAGAGCCTGAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87} {0: 1, 1: 0, 2: 4, 3: 33, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!