ID: 928319209_928319214

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 928319209 928319214
Species Human (GRCh38) Human (GRCh38)
Location 2:30269789-30269811 2:30269820-30269842
Sequence CCCATAAAACCACTACCCAGGTC GAACGCTGTCACACCCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 30, 4: 207} {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!