ID: 928511674_928511682

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 928511674 928511682
Species Human (GRCh38) Human (GRCh38)
Location 2:32009782-32009804 2:32009797-32009819
Sequence CCGGGCACACCGTCCTTCCCGGG TTCCCGGGGGTGGCAGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137} {0: 1, 1: 1, 2: 1, 3: 24, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!