ID: 928511684_928511687

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 928511684 928511687
Species Human (GRCh38) Human (GRCh38)
Location 2:32009800-32009822 2:32009822-32009844
Sequence CCGGGGGTGGCAGCGGCCGGCCG GCACGCTTCCTGCAAGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 366} {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!