ID: 928511686_928511694

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 928511686 928511694
Species Human (GRCh38) Human (GRCh38)
Location 2:32009820-32009842 2:32009842-32009864
Sequence CCGCACGCTTCCTGCAAGCCAGA AGGCGGCGACAAGTCGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177} {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!