ID: 928511776_928511785

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 928511776 928511785
Species Human (GRCh38) Human (GRCh38)
Location 2:32010097-32010119 2:32010117-32010139
Sequence CCGCCGCGGGGCCGGGCCGCCGA CGACCTCGGCCGGCCGGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 218} {0: 1, 1: 0, 2: 3, 3: 30, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!