ID: 928586237_928586238

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 928586237 928586238
Species Human (GRCh38) Human (GRCh38)
Location 2:32761294-32761316 2:32761311-32761333
Sequence CCAGAATCAGACTGCTTCTTACC CTTACCACCTCCTGTCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 239} {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!