ID: 928609721_928609725

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 928609721 928609725
Species Human (GRCh38) Human (GRCh38)
Location 2:32980925-32980947 2:32980978-32981000
Sequence CCAGTGAAAAGCCTGCTGCCAGA TCTTTTCTCTTGCTGCTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 300, 3: 576, 4: 743} {0: 303, 1: 527, 2: 531, 3: 599, 4: 1802}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!