ID: 928609868_928609874

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 928609868 928609874
Species Human (GRCh38) Human (GRCh38)
Location 2:32982467-32982489 2:32982508-32982530
Sequence CCCAAGACAGTGGGCTTAATCAC AGTTAATCACCAAGACAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141} {0: 1, 1: 40, 2: 680, 3: 1193, 4: 1655}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!