ID: 928622333_928622337

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 928622333 928622337
Species Human (GRCh38) Human (GRCh38)
Location 2:33103771-33103793 2:33103799-33103821
Sequence CCATCCTGCTTGTTGAGTAGCAT CATCCTTCTCAACAACTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!