|
Left Crispr |
Right Crispr |
| Crispr ID |
928805180 |
928805182 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:35141254-35141276
|
2:35141296-35141318
|
| Sequence |
CCTTCCATCATCTGTAAAAAACT |
TAAACAACCCCATTAAAAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 62, 1: 1352, 2: 15599, 3: 10820, 4: 7834} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|