ID: 928924020_928924024

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 928924020 928924024
Species Human (GRCh38) Human (GRCh38)
Location 2:36557866-36557888 2:36557912-36557934
Sequence CCTTGAAGGTGCATTATCTTTGT CAAGTGCCCAGATCATGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 243} {0: 1, 1: 0, 2: 3, 3: 34, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!