ID: 928948070_928948081

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 928948070 928948081
Species Human (GRCh38) Human (GRCh38)
Location 2:36789934-36789956 2:36789974-36789996
Sequence CCTTCTCCCCTCTGTTACCACTG TTCCTGGAAGATTCCTTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 371} {0: 1, 1: 0, 2: 5, 3: 23, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!