ID: 929070023_929070036

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 929070023 929070036
Species Human (GRCh38) Human (GRCh38)
Location 2:38020543-38020565 2:38020582-38020604
Sequence CCGGCGCTTGCGGGCCAGCTGGA GGCTTGGCGGGCCCCACACTGGG
Strand - +
Off-target summary {0: 13, 1: 7, 2: 9, 3: 26, 4: 121} {0: 42, 1: 311, 2: 396, 3: 316, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!