ID: 929169883_929169887

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 929169883 929169887
Species Human (GRCh38) Human (GRCh38)
Location 2:38921017-38921039 2:38921034-38921056
Sequence CCCTGCAGGTCAATTCCAGTTAG AGTTAGCCTCAAGAACATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95} {0: 1, 1: 0, 2: 2, 3: 12, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!