|
Left Crispr |
Right Crispr |
| Crispr ID |
929188137 |
929188146 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:39116572-39116594
|
2:39116617-39116639
|
| Sequence |
CCTACTTAAAACTTATTGGCTGG |
CCTAGCACTTTGGGAAGCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 22, 4: 220} |
{0: 372, 1: 12313, 2: 110809, 3: 227930, 4: 245179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|