ID: 929195477_929195481

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 929195477 929195481
Species Human (GRCh38) Human (GRCh38)
Location 2:39180347-39180369 2:39180362-39180384
Sequence CCCAGACAATTGCGTTGCCTGAG TGCCTGAGGCTGCCCCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 176} {0: 1, 1: 0, 2: 16, 3: 163, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!