ID: 929302640_929302646

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 929302640 929302646
Species Human (GRCh38) Human (GRCh38)
Location 2:40323671-40323693 2:40323707-40323729
Sequence CCAATGCCCAGTTCCTAAGGGGG AACAAACCCTCCTACCCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 238} {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!