ID: 929311901_929311904

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 929311901 929311904
Species Human (GRCh38) Human (GRCh38)
Location 2:40435264-40435286 2:40435297-40435319
Sequence CCACTACCAAGGCAAGCACTTCC AGACAAAGAGATGATGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 184} {0: 1, 1: 0, 2: 2, 3: 33, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!