ID: 929453430_929453440

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 929453430 929453440
Species Human (GRCh38) Human (GRCh38)
Location 2:42050905-42050927 2:42050932-42050954
Sequence CCTACAGTGGGGTCTTCCTGCCC GGCTTCAGGGCAGGTGTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 202} {0: 1, 1: 0, 2: 2, 3: 23, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!