ID: 929528173_929528179

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 929528173 929528179
Species Human (GRCh38) Human (GRCh38)
Location 2:42725770-42725792 2:42725813-42725835
Sequence CCTGCTCCAGCACTGCAGAATCC GACACAGAGCCAGACAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 349} {0: 1, 1: 1, 2: 3, 3: 41, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!