ID: 929623357_929623361

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 929623357 929623361
Species Human (GRCh38) Human (GRCh38)
Location 2:43380682-43380704 2:43380705-43380727
Sequence CCCCAATCTTGGTTTCGAATACC ATTCTCCAATAAAAGAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 78, 4: 230} {0: 6, 1: 80, 2: 206, 3: 378, 4: 788}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!