ID: 929671119_929671123

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 929671119 929671123
Species Human (GRCh38) Human (GRCh38)
Location 2:43876983-43877005 2:43877012-43877034
Sequence CCATGAGAATATAGGGAGACCAT ATGAAGAAACTGTGTGAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 743} {0: 1, 1: 1, 2: 3, 3: 37, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!