ID: 929755534_929755540

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 929755534 929755540
Species Human (GRCh38) Human (GRCh38)
Location 2:44761086-44761108 2:44761104-44761126
Sequence CCTTGGGGGCAGGGAGTGGAGGT GAGGTGGCCAACTGGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 60, 4: 591} {0: 1, 1: 0, 2: 2, 3: 36, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!