ID: 929756680_929756685

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 929756680 929756685
Species Human (GRCh38) Human (GRCh38)
Location 2:44771746-44771768 2:44771781-44771803
Sequence CCCAGCTCTGCCTTCTGTCAAGT ATAGAGGTCAAAGTGCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 412} {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!