ID: 929848190_929848197

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 929848190 929848197
Species Human (GRCh38) Human (GRCh38)
Location 2:45555073-45555095 2:45555088-45555110
Sequence CCCTCCACGATCCCCTTAAAAAT TTAAAAATCCTAGCCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 39, 3: 87, 4: 200} {0: 1, 1: 0, 2: 9, 3: 62, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!